Cloning of scFv Fragments

Cloning of Single-Chain Fv Fragments (scFv)

The Fv fragment of an antibody consists of a ~25 kDa heterodimer made of the VH and VL domains. The Fv fragment is the smallest fragment that holds a complete binding site of an antibody (Fig. 1). Single-chain Fv fragments or scFv are obtained by connecting the VH and the VL domains by a linker in a single polypeptide. This protocol it just intended to provide a quick guide to some of the main aspects of their cloning and is not a substitute for the vast literature on this subject.

Figure 1. Schematic representation of a scFv fragment.

Domain orientation and tag location

There is not preferential orientation of one domain to the other and VH-L-VL and VL-L-VH constructs are likely equivalent. ScFv fragments are independent folding entities that can be fused indistinctively on either end to other epitope tags or protein domains. For example the FLAG tag has been extensively used on the N-terminal end (Krebber et al., 1997) while many vectors including PHEN1 (Hoogenboom et al., 1991) have the tag located on the C-terminal end. Purification tags, e.g. HIS tag, Streptag, must obviously be located on the C-terminal side to prevent purification of truncated proteins; C-terminal epitope tags are often located after the purification tag, likely to make them more accessible. In the case of phage display, an amber codon is often added between the scFv and the phage coat protein to allow secretion in the periplasmic space of free scFv for binding analysis purpose. Since epitope tags are a source of proteolysis and amber codon are not fully suppressed in vivo, the combination of epitope tag plus amber codon hinders display to some extend.

Linker length

Once the domain orientation has been chosen, a linker must be designed. It is now well-established that linkers too short will prevent the physical association of the two domains and lead to the formation of multimers (diabodies, tribodies, etc.) while linkers too long may favor proteolysis or weak domain association. Linkers of length between 15 a.a. and 20 a.a. are most often used. Some people have argued that the upper range, 18 a.a. to 20 a.a., is better to prevent the formation of dimeric forms.

Linker sequence

Many linker sequences if not most of them are multimers of the pentapeptide GGGGS (or G4S or Gly4Ser). Those include the very popular 15-mer (G4S)3 found in some of the first scFv fragments (Huston et al., 1988), the 18-mer GGSSRSSSSGGGGSGGGG (Andris-Widhopf et al., 2011) and the 20-mer (G4S)4 (Schaefer et al., 2010). Many other sequences have been proposed, including sequences with added functionalities, e.g. an epitope tag or an encoding sequence containing a Cre-Lox recombination site (Sblattero & Bradbury, 2000) or sequences improving scFv properties, often in the context of particular antibody sequences.

Cloning methodology

Cloning of the scFv is usually done by a two-step overlapping PCR (also known as Splicing by Overlap Extension or SOE-PCR). The VH and VL domains are first amplified and gel-purified and secondarily assembled in a single step of assembly PCR (Fig. 2). The linker is generated either by overlap of the two inner primers or by adding a linker primer whose sequence covers the entire linker or more (three-fragment assembly PCR). The assembly PCR contains an equal amount of VH and VL domains, e.g. between 50 ng and 100 ng of each domain, and a lower amount of linker primer to prevent the preferential amplification of one domain, e.g. between one molar equivalent and 1/3 in weight of one domain. The outer primers during the assembly PCR can be either the primers that were used to amplify the domains or a new pair of extension primers; this last choice offers the possibility to extend the sequence on both sides of the scFv either to add restriction sites or to amplify the assembly independently of the domain sequence, an interesting situation when libraries are build. Some people do perform a few PCR cycles to assemble the two domains before adding the pair of outer primers, although the advantage of such a methodology is not clearly established.

Figure 2. Principle of scFv PCR assembly. Between 4 and 7 primers will be needed to assemble a complete scFv. A linker primer is required when the inner primers do not overlap; the extension primers are optional but usually found in most constructions. The adapter sequences are the only elements dependent on the cloning vector.

Examples of assembly reactions

Assembly of the classical (G4S)3 linker has been described many times, either as a three-fragment assembly (Marks & Bradbury, 2004) or a two-fragment assembly. Here is a classical approach for the two-fragment assembly:

Translation                     G  G  G  G  S  G  G  G  G  S  G  G  G  G  S
Linker primer                   GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG
Inner primer (s)                               GGCGGAGGTGGCTCTGGCGGTGGCGGATCG-Vstart
Inner primer (rc)          Jend-GGTGGAGGCGGTTCAGGCGGAGGTGGCTCT

Note: s – sense primer, r – reverse primer, rc - reverse complement of reverse primer.
A variant of the two-fragment assembly of the (G4S)3 linker (Benhar, 2002):

Translation                     G  G  G  G  S  G  G  G  G  S  G  G  G  G  S
Linker                          GGAGGTGGTGGATCCGGCGGTGGCGGTTCTGGTGGAGGTGGATCT
Inner primer (s)                               GGCGGTGGCGGTTCTGGTGGAGGTGGATCT-Vstart
Inner primer (rc)          Jend-GGAGGTGGTGGATCCGGCGGTGGCGGTTCT

Note: s – sense primer, r – reverse primer, rc - reverse complement of reverse primer.

A two-fragment assembly of the 18-mer GGSSRSSSSGGGGSGGGG linker (Barbas et al., 2001). The sense inner primer contains the full linker sequence while the reverse inner primer only covers 7 a.a.; this comes in handy to build scFv fragments with a shorter linker:

Translation                     G  G  S  S  R  S  S  S  S  G  G  G  G  S  G  G  G  G
Linker                          GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGGCGGTGGTGGG
Inner primer (s)                GGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGGCGGTGGTGGG-Vstart
Inner primer (rc)          Jend-GGTGGTTCCTCTAGATCTTCC

Note: s – sense primer, r – reverse primer, rc - reverse complement of reverse primer.

A two-fragment assembly of a (G4S)4 linker (Krebber et al., 1997) (Schaefer et al., 2010):

Translation               G  G  G  G  S  G  G  G  G  S  G  G  G  G  S  G  G  G  G  S 
Linker                    GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGCGGCGGCGGCTCCGGTGGTGGTGGATCC
Inner primer (s)                                        GGCGGCGGCGGCTCCGGTGGTGGTGGATCC-Vstart
Inner primer (rc)    Jend-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGCGGCGGCGGCTCC

Note: s – sense primer, r – reverse primer, rc - reverse complement of reverse primer.

Cloning in the pADL™ phagemid vector series

The following design has been applied successfully to clone scFv fragments with the 20-mer (G4S)4 linker in the pADL vector series using a three-fragment assembly. These highly repetitive primers require a high degree of purity, a hot-start PCR reaction and high annealing temperature to prevent the loss of repeats during amplification:

LINKER
Translation               G  G  G  G  S  G  G  G  G  S  G  G  G  G  S  G  G  G  G  S
Linker primer             GGTGGTGGTGGTTCTGGTGGTGGTGGTTCCGGCGGCGGCGGCTCTGGTGGTGGTGGATCC
Inner primer (rc)    Jend-GGTGGTGGTGGTTCTGGTGG  
Inner primer (s)                                                  GCTCTGGTGGTGGTGGATCC-Vstart

Note: s – sense primer, r – reverse primer, rc - reverse complement of reverse primer.

The outer primers were obtained by adding the following extensions to the N-terminal V sequence or the C-terminal J sequence:

N-TERMINAL
Restriction sites                       SfiI/BglI  NcoI
Translation                        L  A  A  Q  P  A  M  A  
Outer V primer (s)            5’-TACTCGCGGCCCAGCCGGCCATGGCT-Vstart
Outer primer II (s)              TACTCGCGGCCCAGCCGGCCA

C-TERMINAL
Restriction sites                 SpeI  SfiI/BglI
Translation                  Jend T  S  G  P  G  G  Q  H  H  
Outer J primer (rc)          Jend-ACTAGTGGCCCGGGAGGCCAACACCA-3’  
Outer primer II (rc)                   TGGCCCGGGAGGCCAACACCA

Note: s – sense primer, r – reverse primer, rc - reverse complement of reverse primer.

The second pair of outer primers does not overlap with either the V or the J regions and has been successfully used to reamplify assembled scFv inserts by PCR reaction to create large libraries.

References

  1. Andris-Widhopf, J., Steinberger, P., Fuller, R., Rader, C., & Barbas, C. F. (2011). Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences. Cold Spring Harbor protocols, 2011(9).

  2. Barbas, C. F., Burton, D. R., Scott, j k, & Silverman, G. J. (2001). Phage Display: A Laboratory Manual. Cold Spring Harbor Laboratory Press.

  3. Hoogenboom, H. R., Griffiths, A. D., Johnson, K. S., Chiswell, D. J., Hudson, P., & Winter, G. (1991). Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res, 19(15), 4133–4137.

  4. Huston, J. S., Levinson, D., Mudgett-Hunter, M., Tai, M. S., Novotný, J., Margolies, M. N., Ridge, R. J., et al. (1988). Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 85(16), 5879–83.

  5. Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H. R., & Pluckthun, A. (1997). Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J Immunol Methods, 201(1), 35–55.

  6. Marks, J. D., & Bradbury, A. (2004). PCR cloning of human immunoglobulin genes. Methods in molecular biology (Clifton, N.J.), 248, 117–34.

  7. Schaefer, J. V, Honegger, A., & Pluckthun, A. (2010). Construction of scFv Fragments from Hybridoma or Spleen Cells by PCR Assembly. (R. Kontermann & S. Dübel, Eds.)

 

Please send comments to info@abdesignlabs.com.

Copyright © 2014 Antibody Design Labs. All rights reserved. The reuse or reproduction of any of the information, design or layout contained in this web site without the permission of Antibody design Labs is prohibited.

Comments are closed.