1-877-223-3104 | 
Cart is empty
Catalog
Recently Viewed
MIM™-12 Phage Display Peptide Library Kit
Technical Description
The MIM™-12 Phage Display Peptide Library consists of ~109 random linear 12-mer peptides displayed as an N-terminal fusion protein with the minor coat protein pIII on the head of the fd filamentous bacteriophage. The sequence of the insert is NH2-X12GGGSGPGGLRGGS-pIII after cleavage of the leader peptide. The library was built on the phage vector fADL-2blue using degenerated NNK codons. fADL™-2blue is a multivalent type 3 phage display vector (Smith 1997) derived from the phage vector fd-tet (Zacher 1980). fADL-2blue is well tolerated by the host and gives large colonies and small plaques, simplifying the screening of libraries and the handling of single clones. Helper phage are not required for amplification. The linker GGGSGPGGLRGGS is sensitive to trypsin, enabling trysin elution, which has been show to improve motif recovery (Thomas 2010).
Figure 1. Principle of library selection through iterative rounds of biopanning.
The MIM™-12 Phage Display Peptide Library Kit holds enough material for 10 panning experiments (Fig. 1). Each aliquot of 10 µl contains 2 x 1010 cfu, equivalent 20 transducing units per peptide on average. Panning of the library leads to the rapid identification of peptide binders (Fig. 2).
Figure 2. M2 Antibody Epitope Mapping. Panning of the MIM-12 library by the FLAG® tag M2 antibody leads to all sequences analyzed with motifs matching the tag sequence on the third round.
Applications
-
Epitope mapping.
-
De novo isolation of peptide binders.
-
Identification of peptide binding motifs.
For research use only; not intended for any animal or human therapeutic or diagnostic use.
Kit Components
The following reagents are included with the kit:
|
Component |
Description |
Amount |
|---|---|---|
|
MIM™ LIBRARY |
100 μl phage, ~ 2 x 1012 cfu/ml. Supplied in TBS with 10% glycerol, enough for 10 screening campaigns. |
100 μl |
|
PHI8S3 PRIMER |
5’- CAAGCTGTTTAAGAAATTCACCTCG, 1 nmol, 10 μM, 10 pmol/μl |
100 μl |
|
PSIR2 PRIMER |
5’-CGTTAGTAAATGAATTTTCTGTATGAGG, 1 nmol, 10 μM, 10 pmol/μl |
100 μl |
|
TG1 |
Phage-Competent™ TG1 cells, 20 OD600/ml, >2 x 1010 cfu/ml |
0.5 ml |
|
SS320 |
Phage-Competent™ SS320 cells, 20 OD600/ml, >2 x 1010 cfu/ml |
0.5 ml |
Associated Products
The following products can be used during panning (Phage-Competent cells), cloning single clones or building new libraries (Vector):
|
Product |
Composition |
Amount |
|---|---|---|
|
MIM™-C10 Phage Display Peptide Library Kit |
1 kit |
|
|
MIM™-12 Phage Display Peptide Library Kit |
1 kit |
|
|
fADL™-2blue Phage Vector. 20 µl at 0.5 µg/µl of DNA vector in DNA Conservation Buffer (Tris-HCL 5 mM, EDTA 0.1 mM, pH 8.5) |
10 μg |
|
|
Phage-Competent™ TG1 cells, 20 OD600/ml, >2 x 1010 cfu/ml |
10 x 0.5 ml |
|
|
Phage-Competent™ SS320 cells, 20 OD600/ml, >2 x 1010 cfu/ml |
10 x 0.5 ml |
Quality Control & Certification of Analysis
Quality Control Assays
Specifications for each lot are reported in the certificate of analysis.
Certification
Product meet all specifications.
References
- Thomas WD, Smith GP. (2010). The case for trypsin release of affinity-selected phages. Biotechniques,49(3):651‐654.
- Smith, GP. and Petrenko, VA. (1997). Phage Display. Chemical Reviews, 97(2), 391–410.
- Zacher 3rd, A. N., Stock, C. A., Golden 2nd, J. W., AND Smith, G. P. (1980). A new filamentous phage cloning vector: fd-tet. Gene, 9(1-2), 127–140.
